Werner & Ingbar's The Thyroid: A Fundamental & Clinical Text, 9th Edition

8.Genomic and Nongenomic Actions of Thyroid Hormones

Paul M. Yen

Thyroid hormone (TH) (e.g., L-triiodothyronine, T3; L-tetraiodothyronine, T4) regulates a wide range of cellular and physiologic activities such as growth, development, metabolism (1,2,3). TH has prominent effects during gestation and early childhood. In humans, TH's critical role in development is demonstrated by the distinctive neurological and physical deficits that occur in cretins from iodine-deficient areas. TH also has important effects on growth and development in the latter stages of childhood. However, unlike its early developmental-specific effects, growth and eumetabolism are restored after the institution of TH treatment. TH's primary effects in adults are mostly metabolic. These effects include changes in oxygen consumption, protein, carbohydrate, lipid, and vitamin metabolism. Dramatic clinical improvement and correction of metabolic derangements in hypothyroidism occur with TH therapy. Taken together, the clinical and metabolic manifestations of hypo- and hyperthyroidism highlight TH's myriad effects on many different pathways and target organs.

Since the initial description of TH effects on metabolic rate more than 100 years ago, (4) many theories have been proposed to explain its mechanism of action. They have included uncoupling of oxidative phosphorylation, stimulation of energy expenditure by the activation of Na+-K+ adenosinetriphosphatase (ATPase) activity, and direct modulation of TH transporters and enzymes in the plasma membrane and mitochondria (5). While TH may have some activities at nongenomic sites such as the plasma membrane, cytoplasm, and mitochondrion, it appears that TH exerts its major effects at the genomic level. In 1966, Tata et al. proposed that TH increased gene expression with concomitant increases in protein synthesis and enzyme activity (6). In the early 1970s, the Samuels and Oppenheimer groups identified high-affinity nuclear-binding sites for TH (Kd [dissociation constant] approximately 10-10 M for T3) (7,8). The receptor-binding affinity of various THs and analogues correlated with their biologic potencies, suggesting that most biologic effects were mediated by a nuclear receptor (1).

During the past 15 years, much progress has been made in our understanding of the molecular mechanisms involved in TH regulation of gene transcription due to the cloning of the thyroid hormone receptor (TR) isoforms (9,10), identification of regulatory DNA elements in TH-responsive genes (3,11), and generation of TR isoform knockout mice (12,13). A general schema has emerged for TH effects on gene transcription (Fig. 8.1). Circulating free TH enters the cell, most likely via plasma membrane transporters. Additionally, the more biologically active T3 may be converted intracellularly from circulating serum T4 in some tissues by iodothyronine 5′-deiodinases (see later in this chapter). TH then enters the nucleus, where it binds to the nuclear TRs with high affinity and specificity. TR is a ligand-regulated transcription factor that is intimately associated with chromatin and heterodimerizes with another member of the nuclear receptor superfamily, retinoid × receptors (RXRs). TR/RXR, in turn, is bound to target DNA sequences known as TH-response elements (TREs), generally located in the promoter regions of target genes. The formation of a liganded TR/DNA complex, and subsequent recruitment of transcriptional coactivators, leads to activation of the target gene, with attendant increases in messenger RNA (mRNA) and protein expression. Additionally, TH can negatively regulate some target genes. This chapter will focus on the major aspects of transcriptional regulation by TH, as well as describe some of its nongenomic effects.

FIGURE 8.1. General model for thyroid hormone action in the nucleus.

THYROID HORMONE METABOLISM AND NUCLEAR BINDING OF THYROID HORMONES

Both T4 and T3 are synthesized by the thyroid gland, with T4 as the major product. In many respects, T4 can be considered a prohormone for the more potent hormone, T3. Indeed, most of the intracellular TH bound to nuclear receptors is in the form of T3. The major pathway for the production of circulating T3 is via 5′ deiodination of the outer ring of T4 by deiodinases (14,15). Type I deioidinase is found in peripheral tissues such as liver and kidney, and is responsible for the conversion of the majority of T4 to T3 in circulation. Type II deiodinase has high affinity for T4 (Kd in the nanomolar range) and is found primarily in the pituitary gland, brain, and brown fat, where conversion of T4 to T3 modulates the intracellular concentration of T3. Thus, tissues that contain type II deiodinase can respond differently to a given circulating concentration of T4 (by intracellular conversion to T3) than organs that can only respond to T3. Type III deioidinase, which is found primarily in placenta, brain, and skin, in combination with Type I deiodinase, converts T4 to reverse triiodothyronine (rT3), leading to the inactivation of TH. These deiodinases have recently been cloned and shown to be selenoproteins (16). Additionally, rT3 and T3 can be further deiodinated in the liver and are sulfo- and glucuronide conjugated before excreted in the bile (17). Enterohepatic circulation of TH occurs as intestinal flora deconjugate some of these TH metabolites and promote their reuptake.

T3 binds to its receptors with approximately 10- to 15-fold higher affinity than T4 (1). The dissociation constants for liver nuclear receptors measured in vitro are 2 × 10-9 M for T4 and 2 × 10-10 M for T3. Nuclear receptors are approximately 75% saturated with TH in the brain and pituitary, and 50% saturated with TH in the liver and kidney. Of note, TR occupancy varies among different tissues, and thus provides a mechanism for fine adjustment of circulating TH levels to nuclear receptor concentration. In contrast to the related steroid hormone receptors, TRs are mostly nuclear, both in the absence and presence of TH (3,11). In fact, TRs are tightly associated with chromatin (18,19,20), consistent with their proposed role as DNA-binding proteins that regulate gene expression.

Thyroid Hormone Receptors

In 1986, the Vennstrom and Evans laboratories identified and cloned the TR isoforms, TRα and TRβ (9,10). These ground-breaking studies ushered in the molecular era for our understanding of TRs and TH action. It was quickly noted that the TRs are the cellular homologues (c-erbA) of v-erbA, a viral oncogene product involved in chick erythroblastosis. Furthermore, TRs are members of the nuclear hormone receptor (NR) superfamily that include the steroid, vitamin D, retinoic acid, peroxisomal proliferator, and “orphan” (unknown ligand and/or DNA target) receptors (3,21). TRs act as ligand-regulatable transcription factors that bind both ligand and DNA-enhancer elements or TREs located in the promoters of target genes. TRs have a central DNA-binding domain (DBD) that contains two “zinc-finger” motifs that intercalate with the major and minor grooves of TRE nucleotides sequences, and a carboxy-terminal ligand-binding domain (LBD) Fig. 8.2. The hinge region between these two domains is a stretch of multiple lysines that are important for nuclear localization of the receptor. (3,22,23). Recent X-ray crystallographic studies of the liganded rat TRα-1 and human TRβ LBDs demonstrate that TH is buried in a hydrophobic “pocket” lined by discontinuous stretches of amino acids with additional hydrophobic interfaces likely contributing to RXR heterodimerization (24,25). The LBD is composed of 12 amphipathic helices, with specific helices providing the contact surfaces for protein-protein interactions with coactivators and corepressors (helices 3, 5, 6, 12 and 3, 4, 5, 6, respectively) (26,27,28,29). Ligand-binding induces major conformational changes in the TR LBD, particularly in helix 12, which affect TR interaction with coactivators and corepressors, respectively.

FIGURE 8.2. General organization of major thyroid hormone receptor domains and functional subregions.

There are two gene-encoding TR isoforms (Thra and Thrb) located on human chromosomes 17 and 3, respectively (3,22,23). These genes generate several major TR isoforms, TRβ-1,α-1,α-2, which bind TH with similar affinity and mediate TH-regulated transcription Fig. 8.3. The TR α isoforms, which range from 400 to slightly over 500 amino acids in length among mammalian species, contain highly conserved DBDs and LBDs.

FIGURE 8.3. Comparison of amino acid homologies and their functional properties among thyroid hormone receptor (TR) isoforms' length of receptors is indicated just above receptor diagrams, and percentage of amino acid homology with TRβ-2 is included in the receptor diagrams.

The Thra gene encodes two different proteins, TRα-1 and c-erbAa-2, which are generated by alternative-splicing of Tra mRNA. In the rat and human, these proteins are identical to amino acid residues 1 through 370; however, their respective sequences diverge markedly thereafter (Fig. 8.3). Consequently, c-erbAα-2 cannot bind T3, as it contains a 122-amino-acid carboxy-terminus that replaces a region in TRα-1 LBD required for TH binding. Additionally, c-erbAa-2 binds TREs weakly but cannot transactivate TH-responsive genes. On certain target genes, c-erbAα-2 may act as a dominant negative inhibitor of TH action, possibly by competing for binding to TREs (30,31). Furthermore, the anatagonist activity of c-erbAα-2 may be modulated by its phosphorylation state (32). The TRα-1 and c-erbAα-2 system, then, represents one of the first examples in mammalian species in which multiple mRNAs generated by alternative splicing encode proteins that may be antagonistic to each other. A second TRα variant, c-erbAα2V, in which the first 39 amino acids of the divergent sequence are missing, has been identified (33); however, its function is currently unknown. Yet another surprising aspect of the TRα gene is the use of the opposite strand to generate another gene product, rev-erbA. The mRNA of rev-erbA contains a 269-nucleotide stretch, which is complementary to the c-erbAα-2 mRNA due to its transcription from the DNA strand opposite of that used to generate TRα-1 and c-erbAα-2 (34,35). This protein also is a member of the NR superfamily. It is primarily expressed in fat and muscle, can bind to TREs and retinoic acid response elements and can repress transcription of target genes containing these elements (36,37,38). Nonetheless, rev-erbA should be considered an orphan receptor since its cognate ligand and function are not known. One potential role for rev-erbA may be the regulation of TRα mRNA splicing increased levels of rev-erbA mRNA correspond with increased TRα-1 mRNA (relative to c-erbAα-2) (39,40,41). It also may help promote adipogenesis (40).

The Thrb gene encodes two major TRβ isoforms (42,43). This gene contains two promoter regions, and by their alternate use, one or both of the coding mRNAs are transcribed (44). The resultant TRβ isoforms are designated as TRβ-1 and TRβ-2. The amino acid sequences of the DNA-binding, hinge-region, and ligand-binding domains of these two TR isoforms are identical; however, the amino-terminal regions are divergent (Fig. 8.3). Both TRβ isoforms have high homologue with TRα-1 DBD and LBD. They bind TREs and TH with high affinity and specificity, and mediate TH-dependent transcription. TRβ-2 is expressed selectively in tissues, and its expression may be regulated by factors such as the pituitary-specific transcription factors, Pit-1 (44).

Both TRα-1 and TRβ-1 mRNAs and proteins are expressed in almost all TRα-1 muscle and brown fat, whereas TRβ-1 mRNA has highest expression in brain, liver, and kidney (45,46). The c-erbAα-2 mRNA is most prevalent in testis and brain. In contrast, TRβ-2 mRNA and protein are expressed tissue-selectively in the anterior pituitary gland and hypothalamus, as well as in the developing brain and inner ear (45,46,47,48,49,50). In the chick and mouse, TRβ-2 mRNA also is expressed in the developing retina (51). Additionally, several short forms of TRα and TRβ generated by alternative-splicing of mRNA or by use of internal transcriptional start sites have been found in embryonic stem cells and fetal bone cells. These short forms may have biological significance in certain tissues, as some of them block wild-type TR transcriptional activity (dominant negative activity) (52,53).

Regulation of the TR isoform mRNAs varies and is cell-type dependent. In the intact rat pituitary, T3 decreases TRβ-2 mRNA, modestly decreases TRα-1 mRNA, and slightly increases rat TRβ-1 mRNA (45). These net changes reduce total T3 binding by 30% in the T3-treated rat pituitary. With the exception of TRβ-1 in the brain, where c-erbAα-2 levels are unaffected, T3 slightly decreases TRα-1 and c-erbAα-2 mRNA in almost all tissues. T3 has minimal effect on TRβ-1 mRNA expression in nonpituitary tissues. Additionally, TRH from the hypothalmus decreases TRβ-2 mRNA, slightly decreases TRα-1 mRNA, and minimally affects TRβ-1 mRNA in GH3 cells (54). Retinoic acid reduces the negative regulation by T3 in these cells (55,56). Additionally, in patients with nonthyroidal illness who had decreased circulating free T3 and T4 levels, TRα and TRβ mRNAs were increased in peripheral mononuclear cells and liver biopsy specimens (57). It is possible that compensatory TR induction may help maintain a eumetabolic intracellular state in these patients.

The amino acid sequences of TR isoforms are highly conserved among mammalian species (43), which suggests that TR isoforms may have specialized functions (58). The evidence for isoform-specific function at individual target genes has been limited despite distinct phenotypes observed when TR isoforms are knocked out in mice (12,13). Recent studies have suggested that TRβ-1 may exhibit isoform-specific regulation of the TRH and myelin basic protein genes, and TRβ-2 may play an important role in the regulation of the growth hormone and TSHB gene expression in the pituitary (59,60,61,62,63). However, complementary DNA (cDNA) microarray studies, in TR isoform knockout mice, suggest that TRα and TRβ provide compensatory transcriptional regulation of target genes (64). Taken together, these data suggest that total TR, rather than specific TR isoform expression, may be the key determinant for transcription levels of target genes, at least in the liver. Future studies with TR knockout mice, RNA silencing, isoform-specific ligands, and antagonists may help resolve the issue of TR isoform-specificity and potentially identify isoform-specific pathways (12,65,66,67,68). It is possible that they provide novel therapies for diseases such as hypercholesterolemia and obesity, while minimizing cardiac side effects, as the heart contains mostly TRα-1 (69).

THYROID HORMONE RESPONSE ELEMENTS

TRs bind to TREs, which are typically located in the upstream promoter regions of target genes. In positively regulated target genes, TREs generally contain two or more hexamer half-site sequence of AGGT(C/A)A arranged in tandem (70). TRs bind to TREs, which have considerable degeneracy in primary nucleotide sequences of half-sites, as well as the number, spacing, and orientation of their half-sites (70,71) (Fig. 8.4. In particular, they can bind to TREs in which half-sites are arranged as direct repeats, inverted palindromes, and palindromes that contain optimal spacing of four, six, or zero nucleotides between half-sites, respectively. Of the approximately 20 to 30 natural positive TREs that have been characterized thus far, direct repeats occur most frequently, followed by inverted palindrome and infrequently palindromes (3,70) (Table 8.1). TR heterodimerization with RXR facilitates binding to a wide repertoire of nucleotide sequences and motifs (71), as RXR proteins enhance TR binding to DNA and reduce the rate of receptor dissociation from DNA (72). The specificity and affinity for the TR/RXR heterodimer is determined by sequences within the half-site, the length of the spacer region, and the sequence context within the spacer region.

TABLE 8.1. NATURALLY OCCURRING THYROID HORMONE RESPONSE ELEMENTS

Gene

Sequence

Position

Positive TREs

Rat growth hormone

AAGGTAAGATCAGGGACGTGACCGC

–190 to–166

Rat myelin basic protein

AGACCTCGGCTGAGGACACGGCGG

–186 to–163

Rat α-myosin heavy chain

CTGGAGGTGACAGGAGGACAACAGCCCTGA

–130 to–159

Rat malic enzyme

AGGACGTTGGGGTTAGGGGAGGACAGTG

–287 to–260

Rat S14

TRE1: TACTTGGGGCCTGGCAGC

–2700 to–2683

TRE2: GTCTAGGGGCCTGAGATG

–2797 to–2814

TRE3: GGTCAAGGGCCTGGCCAG

–2616 to–2633

Pcp-2

AGGCCTTCTCAGGTCAGAGACCAGGAGA

–295 to–268

SERCA2

TRE1: GCGGAGGCAAGCCAAGGACACCAG

–481 to–458

TRE2: GCCGCGACCGCGTAAGGTCGGGCT

–310 to–287

TRE3: CGCGCGGCCTCGATCCGGGTTACTGG

–219 to–194

Synthetic TRE palindrome, based on rat growth hormone

TCAGGTCATGACCTGA

Negative TREs

Rat TSH β-subunit

AGTGCAAAGTAAGGTAGGTCTCTACCCGGC

+15 to +44

TGAACAGAGTCTGGGTCATCACAGCATTAAC

–22 to +4

CGCCAGTGCAAAGTAAG

+11 to +27

Rat α-subunit

TGGGCTTAGGTGCAGGTGGGAGCATGCAATTTGTATT

–74 to–38

Human TSH β-subunit

TTTGGGTCACCACAGCATCTGCTCACCAATGCAAAGTAAGGTAGGT

–3 to +43

Domain 1 (+1 to +17) GGGTCACCACAGCATCT

Domain 2 (+28 to +37) GCAAACTAAG

Human α-subunit

GCAGGTGAGGACTTCA

–22 to–7

Mouse TSH β-subunit

TGAACGGAGAGTGGGTCATCACAGCA

–22 to–3

Human growth hormone

Multiple putative half sites in this region, whole region confers repression in transfections, regions bind in gel shifts, no accurate localization yet

+2021 to +2175

Concentrations of TR protein were calculated as the product of the fractional distribution of the TR protein determined by immunoprecipitation with specific antiserum and the total nuclear binding capacity.

TRE, thyroid hormone response element; TSH, thyrotropin.

From Schwartz HL, Lazar MA, Oppenheimer JH. Widespread distribution of immunoreactive thyroid hormone β2receptor in the nuclei of extrapituitary rat tissues. J Biol Chem 1994;269:24777.

FIGURE 8.4. Conformation of thyroid response elements (TREs). The TREs shown are (top to bottom) a palindrome, a direct repeat + 4 nucleotide spacer (N), and an inverted repeat +6N spacer. N is any nucleotide (A, G, C, or T). The conformations shown are idealized with respect to the constancy of the ACCTCA core sequence and the spacing of the half-sites. As discussed in the text, TREs have a great deal of diversity of sequence and conformation. (From Chin WW. Current concepts of thyroid hormone action: progress notes for the clinician. Thyroid Today 1992;15:1, with permission.)

TRs can interact with a wide variety of other nuclear receptors and transcriptional adaptor proteins (see next section); however, the RXR proteins (a, b, g) are its most important heterodimeric partners (71). RXR also heterodimerizes with the retinoic acid and vitamin D receptors, and promotes binding to their respective hormone response elements. TR/RXR binds to direct repeat TREs with half-site spacing of four nucleotides, whereas vitamin D and retinoic acid receptors bind to response elements with half-site spacing of three or five nucleotides, respectively. The proposed 3-4-5 rule for nuclear receptor specificity on hormone response elements underscores the role of spacing between half-sites as a critical determinant of nuclear receptor binding (73,74). RXR binds to the 5′ sequence, and TR binds to the 3′ sequence in direct repeat TREs (75,76,77). The DBDs interact with the major grooves of the half-sites on the same face of DNA (78). The carboxy-terminal end of the TR DBD forms an α-helical structure that interacts with the spacer region in the DNA minor groove between the TRE half-sites. Although protein-protein contacts between the RXR and TR DBDs contribute to dimerization, their LBDs probably contain the most critical interaction sites (79,80). The dimerization surface of TR appears to involve residues located in helices 10 and 11 (24).

T3 enhances the formation of TR/RXR heterodimers in solution (81). In in vitro studies, unliganded TRs can bind as homodimers and heterodimers to TREs, whereas liganded TRs bind primarily as heterodimers (3). Thus, it is likely that TR/RXR heterodimers play the major role in T3-mediated transcription. The RXRs bind a stereoisomer of all trans retinoic acid, 9-cis retinoic acid (82,83). In combination with T3, 9-cis RA can enhance transcriptional activity of some target genes (3,84).

TRANSCRIPTIONAL REGULATION BY THYROID HORMONE RECEPTORS

A number of TH-responsive target genes have been characterized over the years and are shown in Table 8.1. Recently, cDNA microarrays were used to study TH regulation of hepatic genes in mice and have led to the identification of a large number of novel target genes (both positively and negatively regulated) (85,86). These studies showed that TH affected gene expression in a wide range of cellular pathways and functions, including gluconeogenesis, lipogenesis, insulin signaling, adenylate cyclase signaling, cell proliferation, and apoptosis. Although many of the TH-responsive genes were regulated directly by TRs, others were probably regulated indirectly through intermediary genes. Indirect gene regulation by TH can occur whenever the time course for transcriptional induction is slow (hours) and whenever protein synthesis inhibitors block TH induction. Although TH acts mainly at the level of transcription, it also can affect mRNA stability and translational efficiency (87,88). Thus, TH regulation of protein expression needs to be considered at multiple levels.

THYROID HORMONE RECEPTOR–INTERACTING COREPRESSORS/BASAL REPRESSION

Unliganded TRs not only bind to TREs but repress (or silence) basal transcription of positively regulated target genes in cotransfection studies. This feature of TRs stands in contradistinction to steroid hormone receptors, which are transcriptionally inactive in the absence of ligand (22,89). These initial observations on repression of basal transcription by TRs were puzzling at first, as it was not known whether they represented a genuine feature of TRs or were due to overexpression of TRs and titration of critical cofactors (squelching) in the cotransfection studies. However, our understanding of the mechanism for basal repression by unliganded TRs was greatly aided by the cloning and characterization of two major corepressors called nuclear receptor corepressor (NCoR) and silencing mediator for retinoic acid receptor (RAR) and TR (SMRT) (90,91,92). These 270 kD proteins preferentially interact with unliganded TR and RAR and repress basal transcription of target genes in the absence of their cognate ligands (Figs. 8.5, 8.6). Upon ligand addition, they dissociate from NRs.

FIGURE 8.5. Model for repression, derepression, and transcriptional activation by thyroid hormone receptor.

FIGURE 8.6. Molecular model for basal repression in the absence of L-triiodothyronine (T3) and transcriptional activation in the presence of T3. X refers to possible additional cofactors that remain to be identified. See text for details. CBP, cyclic adenosine monophosphate response element–binding protein; DRIP, vitamin D receptor–interacting protein; GTFs, general transcription factors; HDAC, histone deacetylase; P/CAF, p300/CBP-associated factor; RXR, retinoid X receptor; SRC, steroid receptor coactivator; TAF, TATA-binding protein-associated factor; TBP, TATA-binding protein; TF, transcription factor; TR, thyroid hormone receptor; TRAP, TR-associated protein; TRE, thyroid hormone response element.

These corepressors have three transferable repression domains and two carboxy-terminal α-helical interaction domains. These latter interaction domains contain consensus LXXI/HIXXXI/L sequences, which resemble the LXXLL sequences that enable coactivators to interact with NRs (93). Of note, these sequences allow both corepressors and coactivators to interact with similar amino acid residues on helices 3,5, and 6 of the TR ligand-binding domain. Differences in the length and specific sequences of the corepressor and coactivator interaction sites, combined with ligand-induced conformational changes in the conserved AF-2 region of helix 12, help determine whether corepressor or coactivator binds to TR (93). Additionally, corepressors can bind to RXR as helix 12 of RXR masks a corepressor binding site in RXR, which becomes available after heterodimerization with TR (94).

Recently, it has been shown that corepressors can form a larger complex with other repressors, such as Sin 3 and histone deacetylases (HDACs), that are mammalian homologues of well-characterized yeast transcriptional repressors RPD1 and RPD3 (3,22,93). Thus, histone deacetylation of chromatin near the TREs of target genes may help maintain chromatin structure in a state that shuts down basal transcription. Studies examining TRβA promoter in a Xenopus oocyte system show that simultaneous chromatin assembly and TR/RXR binding are required for basal repression of transcription (95). Addition of T3 relieves this repression and also causes chromatin remodeling. Thus, it is likely that histone deacetylation and acetylation upon ligand addition modulates the chromatin stucture and nucleosome positioning that is critical for target gene transcription. Additionally, DNA methylation may play a role in basal repression as methyl-CpG-binding proteins can associate with a corepressor complex containing Sin 3 and histone deacetylase (96). Finally, unliganded TR can interact directly with the basal transcription factor, TFIIB (97,98), which may promote silencing in some circumstances.

The fact that the TR alters the level of gene transcription in the absence and presence of T3 has important implications for TH physiology. At low hormone concentrations, such as in hypothyroidism, the unliganded receptor is predicted to repress expression rather than function as an inactive receptor. In some respects, this model is borne out by targeted deletion of the TRα and TRβ genes. The phenotypes of these knockout mice are, for the most part, milder than the clinical features observed in congenital hypothyroidism (12,13). Deletion of the receptor may eliminate its ability to function as a repressor in the absence of hormone and allow a milder phenotype due to basal levels of transcription.

THYROID HORMONE RECEPTOR–INTERACTING COACTIVATORS/TRANSCRIPTIONAL ACTIVATION

A growing number of cofactors have been shown to interact with liganded NRs and enhance transcriptional activation (3,21). At present, the precise roles of all these putative coactivators and their respective contribution to ligand-regulated transcription are not known. However, it appears there are at least two major coactivator complexes involved in ligand-dependent transcriptional activation of NRs in mammals: the steroid receptor coactivator (SRC) complex and the vitamin D receptor–interacting protein/ TR-associated protein (DRIP/TRAP) complex (Fig. 8.6). O'Malley and coworkers used the yeast two-hybrid system to identify the first member of SRC family, SRC-1 (99). This 160 kD protein interacts directly with NRs, including TRs, and enhances their ligand-dependent transcription. Subsequent work has shown there are at least two other related members of the SRC family, SRC-2 and SRC-3, that also can enhance transcription by liganded NRs (21). The SRCs contain multiple NR interaction sites that contain a signature LXXLL sequence motif, in which X represents any amino acid. This sequence has been shown to be important for coactivator binding to coactivator interaction sequences in the TR LBD (helices 3, 5, 6, and 12) (100,101). SRCs also interact with the CREB-binding protein (CBP) (the coactivator for cyclic adenosinemonophosphate-stimulated transcription) as well as the related protein, p300 (which interacts with the viral coactivator E1A) (21). CBP/p300 can serve as coactivators for CREB, p53, AP-1, and NF-κ B, and thus may function as integrator molecules for multiple cell-signaling pathways (102).

CBP/p300 can also interact with PCAF (p300/CBP-associated factor), the mammalian homologue of a yeast transcriptional activator, general control nonrepressed protein 5, GCN5 (21,102). Like GCN5, PCAF has histone acetyltransferase activity (HAT), which, in the case of PCAF, is directed primarily toward H3 and H4 histones. PCAF itself is part of a preformed complex that contains TBP associated factors (TAFs), which can interact with SRC-1 and SRC-3. CBP also is part of a stable complex with RNA polymerase II (RNA pol II) (103). Thus, PCAF and CBP possess dual roles as adaptors of nuclear receptors to the basal transcriptional machinery and as enzymes that can alter chromatin structure (HAT activity).

The DRIP/TRAP complex contains approximately 15 subunits, ranging from 70 to 230 kD, which directly or indirectly interact with liganded VDRs and TRs (104,105). A critical subunit in this coactivator complex is DRIP205/TRAP220, which contains a LXXLL motif similar to those found in SRCs, and appears to anchor the rest of the subunit proteins to the NR. It is noteworthy that none of the DRIP/TRAP subunits are members of the SRC family or their associated proteins. Additionally, the DRIP/TRAP complex does not appear to have intrinisic HAT activity. Several DRIP/TRAP components, however, are mammalian homologues of the yeast Mediator complex, which associates with RNA Pol II (104,105). This suggests that TR recruitment of the DRIP/ TRAP complex may help recruit or stabilize RNA Pol II holoenzyme. Recently, another coactivator, TR-binding protein (TRBP), interacts with TR via a LXXLL motif (106). It also can interact with both CBP/p300 and DRIP130, as well as with a DNA-dependent protein kinase (107). The precise interplay between TRBP and the other major coactivator complexes is currently not known.

Recent chromatin immunoprecipitation assays of proteins bound to hormone response elements (HREs) suggest that there may be a sequential, perhaps cyclical, recruitment of different coactivator complexes to HREs (108,109,110). Recently, it has been shown that glucocorticoid and progesterone receptors (GRs and PRs) preferentially recruit different SRC coactivators on the MMTV promoter (111). Thus, it is likely that both temporal recruitment pattern and the particular coactivator recruitment may play key roles in determining the specificity and strength of hormonal response on a given target gene.

In the current model of TR action (Fig. 8.6), p160/SRC complex may initiate transcriptional activity by recruiting cofactors with HAT activity to ligand-bound NRs followed by DRIP/TRAP complex, which can then recruit RNA pol II holoenzyme to promote transcription of target genes. CBP can acetylate ACTR (SRC-3) and promote its dissociation from NRs; thus, acetylation of components of the p160/SRC complex may facilitate the exchange of complexes (112). Recently, it also has been shown that mammalian homologues of Sw-1/Snf, BRG-1 and BRM-1, can associate with NRs in vitro and activate transcription (113). It is possible that these chromatin remodeling proteins with ATPase activity also may be involved in transcriptional activation, particularly in the early stages.

NEGATIVE REGULATION BY THYROID HORMONE RECEPTORS

In contrast to positively regulated target genes, negatively regulated genes can be stimulated in the absence of TH and repressed in response to the ligand. Regulation of TRH and the TSHβ and glycoprotein hormone α-subunit genes have been studied most extensively as models of negatively regulated genes. From a physiological perspective, negative regulation of these genes represents a critical aspect of feedback control of hypothalamic/pituitary/thyroid axis. The T3-responsive regions of these negatively regulated genes have been localized to the proximal promoter regions (70,114,115,116). However, TR binding to putative TREs in these promoters is relatively weak in comparison to the binding sites in positively regulated genes.

The mechanism(s) for negative transcriptional regulation by TH is not well understood, and several different mechanisms may be operative. First, negative regulation may involve receptor interference with the actions of other transcription factors or components of the basal transcriptional machinery (117). For instance, TR can inhibit the activity of AP-1, a heterodimeric transcription factor composed of Jun and Fos (118). T3-mediated repression of the prolactin promoter has been proposed to occur by preventing AP-1 binding (119). The TR also interacts with other classes of transcription factors, including NF-1, Oct-1, Sp-1, p53, Pit-1, and CTCF (120,121,122,123,124). Thus, it is possible that TR binding to such enhancers leads to a reduction in target gene transcription. Second, negative regulation may occur by TR directly binding to DNA sequences of the target gene. A negative TRE (nTRE) of the TSHβ gene resides in an exon downstream of the start site of transcription (114), raising the possibility that it occludes the formation of a transcription complex. Lastly, liganded TRs may potentially recruit positive cofactors off DNA (squelching), which, in turn, could lead to decreased transcription of target genes.

Corepressors and coactivators also may be involved in the control of negatively regulated target genes. In contrast to the basal repression of unliganded TR in the case of positively regulated genes, corepressors cause basal activation of the TSH and TRH genes (62,114,115). Coactivators also play an apparently paradoxical role in T3-dependent repression of negatively regulated genes (125). On the other hand, it appears that HDACs are recruited by TRs during ligand-dependent negative regulation in some instances (126). Cofactor-associated changes in histone acetylation and alterations in chromatin structure may therefore be involved in negative regulation by TR. It is interesting to note that not all negatively regulated target genes are activated in the absence of ligand, suggesting that cofactor may be differentially recruited on promoters of target genes (64). Last, there may be TR isoform specificity in the negative regulation of some target genes, particularly TRβ-2 action on TSH subunits and TRβ-1 on TRH (61,127,128).

RESISTANCE TO THYROID HORMONE

In the syndrome of resistance to thyroid hormone (RTH), affected individuals are usually clinically euthyroid and have thyroid function tests that show elevated circulating free TH levels with concomitant, inappropriately “normal” or elevated TSH levels. RTH is an autosomal dominant disorder in almost all inherited cases (129,130). Patients with RTH typically have mutations in one of three different regions of the TRβ LBD (referred to as “hot spots”). These mutations often reduce the TH-binding affinity of the mutant TR (67,129). Additionally, the mutant TR exerts dominant negative activity on wild-type TRs by blocking TH-regulated transcription of target genes. Dimerization and DNA-binding of the mutant TR are required for dominant negative activity, as formation of inactive heterodimers or homodimers on TREs are necessary to actively compete for DNA-binding with wild-type TRs (131). Recently, several studies have shown that TRβs containing mutations in the AF-2 region of the LBD have dominant negative activity (132,133,134). These mutants typically have normal T3-binding affinity but are unable to interact with coactivators. Thus, mutant TRs that cannot interact with coactivators can also cause RTH. Additionally, mutant TRs that have defective release from corepressors in the presence of TH have strong dominant negative activity (135,136,137). In most cases, decreased T3-binding affinity correlates with decreased corepressor release. Taken together, these findings suggest that transcriptionally inactive TRs, which have either reduced corepressor release or coactivator interaction, are able to mediate dominant negative activity.

Several patients with clinical features of RTH and who do not have TRβ or TRβ mutations have recently been described (138). It is possible that mutations in cofactors or their inappropriate expression may have caused the RTH phenotype observed in these patients. In this connection, Weiss et al have shown that loss of a coactivator, SRC-1, can lead to mild RTH in mice (139).

There also have been several somatic TR mutations described in human tumors. Somatic mutations in TRα and TRβ have been found in hepatic, renal cell, and thyroid carcinomas (140,141). It is not known whether these mutant TRs directly contribute to oncogenesis or are a secondary phenomenon. Recently, a somatic TRβ mutation and an aberrantly spliced TRβ-2 mRNA have been identified in TSH-secreting adenomas (142,143). These resultant aberrant TRs have dominant negative activity and likely cause dysregulation of TSHb and glycoprotein hormone, a subunit expression in these tumors.

THYROID HORMONE RECEPTOR ISOFORM KNOCKOUT AND KNOCKIN MICE

Several mouse models of RTH have been developed in which transgenic mice express dominant-negative mutant TRs ubiquitously or in selective tissues. Recently, targeted gene inactivation [knockout (KO)] of TR isoforms and targeted gene expression of mutant TRs in the appropriate TRα or TRβ gene loci [knockins (KIs)] have provided insight on TH effects on development, metabolism, and physiology, as well as on RTH (12,144,145,146,147).

Transgenic mice with ubiquitous expression of v-erbA and a natural frameshift TRβ-1 mutation have been generated (148,149). The mice that expressed v-erbA had multiple abnormalities including hypothyroidism (due to follicular disorganization in the thyroid), inappropriate TSH response, enlarged seminal vesicles, hepatomas, decreased fertility, and reduced adipose tissue. Since v-erbA has dominant negative activity on retinoic acid–mediated transcription, it is possible that some of these effects may be due to blockade of RAR-, in addition to T3-, mediated transcription. The transgenic mice that expressed the mutant TRβ-1 had elevated T3, inappropriately normal TSH, behavioral abnormalities, decreased fertility, and decreased weight. These findings resembled some of the clinical features of RTH patients with this mutation. Mutant TRβs have also been selectively targeted to tissues such as pituitary, heart, and liver, and have exhibited RTH in these tissues while maintaining TH sensitivity in other tissues (12).

Several different TRα KO mice with different phenotypes have been generated (150,151). The TRα gene structure is complex, as it encodes TRα-1, c-erbAα-2 (which cannot bind T3), and rev-erbA (generated from the opposite strand encoding TRα); thus, the site of homologous recombination determines which isoforms will be knocked out (34). Transgenic mice that lack both TRα-1 and c-erbAα-2 (TRα-/-) have a more severe phenotype with hypothyroidism, intestinal malformation, growth retardation, and early death shortly after weaning (150). Transgenic mice that lack only TRα-1 (TRα-1-/-) have a milder phenotype with decreased body temperature and heart rate, and prolonged QT interval on EKG (151). These findings suggest a major role for TRα-1 in regulating cardiac function. Although the differences between the two phenotypes could be due to specific functions of c-erbAa-2, this is unlikely, as the specific KO of c-erbAa-2 did not affect survival of the pups (12). Short TRα isoforms generated from internal transcriptional start sites, which can block TR transcriptional activity, have been described (52); thus, it is likely that these short TR isoforms may be responsible for the more severe phenotype of the TRα-/- KO mice. Indeed, a TRα KO that lacks all TRα isoforms, including the short TR isoforms (TRα%), has a milder phenotype than TR α-/- (152). Interestingly, TH stimulation of some target genes was increased in these mice, perhaps due to the absence of c-erbA α-2, which inhibits normal TH-mediated transcription.

TRβ KO mice that lack both TRβ-1 and TRβ-2 (TRβ-/-) have been generated. These mice have elevated serum TSH and T4 levels, thyroid hyperplasia, and hearing defects (153,154), and thus resemble the index cases of RTH who also had deletions of TRβ (155). TSH elevation occurs in hypothyroid TRβ-/- mice, but suppression of TSH by TH is impaired (156). Additionally, these findings implicate TRβ in the development of the auditory system (154). Recently, TRβ-2 has been selectively knocked out (127). These mice had elevated levels of TH and TSH, implicating TRβ-2 as an important regulator of TSH. Interestingly, these mice did not have any hearing defects, suggesting that TRβ-2 may not be absolutely required for auditory development, or that its function may be compensated by other TR isoforms, particularly TRβ-1.

The relatively mild phenotypes of both the TRα and TRβ KO mice suggests the two isoforms may have redundant transcriptional activity and compensate for each other in most target genes. Indeed, microarray studies of hepatic gene expression in the TR isoform KO mice show a similar pattern (64). Additionally, overexpression of TRα was able to rescue the hearing deficits in TRβ KO mice (157). Taken together, these findings suggest that TR expression levels, rather than isoform-specific function or tissue-specific expression may be the key determinant of TH action in a given tissue. Double TRα-1 -/-/TRβ-/- and TRα%/ TRβ-/- KOs have been generated and surprisingly, are viable (158,159). They have markedly elevated T4, T3, and TSH levels and large goiters. They also have growth retardation and decreased fertility, as well as impaired bone development and reduced bone mineral content. Of note, the double KO mice have a milder phenotype than congenitally hypothyroid mice. Thus, the absence of TRs does not give the same phenotype as absence of hormone, as basal repression of target genes may be occurring in the latter condition (64). In this connection, recent microarray studies comparing the gene expression profiles of these mice show that different sets of target genes are regulated by these mice.

Two groups recently have generated KI mouse models in which mutant TRs are introduced into the endogenous TRβ gene locus (144,145). When a frameshift mutant TRβ PV was introduced, the heterozygous mice had elevated serum T4 and TSH, mild goiter, hypercholesterolemia, impaired weight gain, abnormal bone development, and resembled patients with RTH (144). Homozygous mice had markedly elevated serum T4 and TSH and a much more severe phenotype. Interestingly, homozygous mice had an increased incidence of thyroid cancer, suggesting that dominant negative activity by mutant TR may contribute to oncogenesis in this tissue (160). When a dominant negative TRβ mutant was introduced into the TRβ gene locus, abnormalities in cerebellar development and function in mutant TRβ-1 KO mice were observed that were not present in TRβ KO mice. These findings implicate corepressors in mediating the deleterious effects by unliganded TR in the hypothyroid brain (145). Recently, three groups have generated KO mice expressing different mutant TRαs (corresponding to natural TRβ mutations) in the endogenous TRβ gene locus (146,147,161). These mice had decreased growth and decreased TH levels. The difference between the observed phenotypes of TRα and TRβ mutant KOs raises the possibility of isoform-specific effects on basal repression and dominant negative activity. Interestingly, one knockin TRα-1 mouse had increased visceral adiposity, insulin resistance, and decreased catecholamine-induced lipolysis (161). The reasons for these differences among the TRα KO mice remain to be elucidated. Recently, a KO mouse expressing a mutant TRβ that cannot bind DNA was generated. This model should be useful in distinguishing signaling and developmental patterns due to protein-protein interactions of TRs (e.g., AP-1) from those that require TR binding to TREs of target genes (162,163).

NONGENOMIC EFFECTS OF THYROID HORMONE

The major effects of T3 are mediated by nuclear TR regulation of target gene transcription. However, nongenomic effects by T3 and T4 also have been documented, although the precise mechanisms for these effects are not well understood (5). Evidence suggesting these nongenomic effects include the lack of dependence on nuclear TRs; structure–function relationships of TH analogues that are different than their affinities for TRs; rapid onset of action (typically seconds to minutes); occurrence in the face of transcriptional blockade; and utilization of membrane-signaling pathways, typically involving kinases or calmodulin, that have not been implicated directly in nuclear TR function.

Transport of T3 across plasma and nuclear membranes has been studied extensively. T3 is lipophilic and generally thought to diffuse passively across the plasma and nuclear membranes. However, there is evidence for facilitated transport across plasma membranes and high-affinity TH-binding sites in the plasma membranes of different cells (164,165,166,167,168). In one study of human erythrocytes, T3 is concentrated 55-fold inside cells. Furthermore, a 58-fold higher concentration of L- T3 and a fourfold higher concentration of D- T3 in the nucleus than in the cytoplasm, using isotope dilution methods, suggest there may be a stereospecific transporter of T3 into the nucleus, although it is possible that differences in TR concentration also contribute to this difference (165,169). Several proteins have been suggested as putative TH transporters. One potential transporter may be the multidrug resistance P glycoprotein, which can modulate TH concentration when overexpressed in cells (168). Other transporters, such as the organic anion, monocarboxylate, and System L transporters, have been shown to import TH into hepatocytes (170,171,172,173,174). Of note, patients with mutations in the monocarboxylate transporter 8 have severely impaired neurological development as well as RTH (175,176).

Other potential targets of T3 in the plasma membrane are calcium ATPase, adenylate cyclase, and glucose transporters (164,165,166,167,177,178,179,180). In the last case, T3 enhances uptake of sugars in a variety of tissues via a mechanism that does not require new protein synthesis, suggesting a direct effect on the plasma membrane transport system (177,178,181). Additionally, T3 binds to an endoplasmic reticulum associated protein, prolyl hydroxylase, and to a subunit of pyruvate kinase when the enzyme is monomeric but not tetrameric (182,183,184). It is not known whether T3 modulates the activities of these enzymes or whether these enzymes may be involved in other functions related to T3 action such as transport or storage. In this connection, T4, inhibits deiodinase type II activity by an allosteric mechanism and may promote targeting of a substrate-binding subunit to endosomes (185). Additionally, deiodinase type II can be proteosomally degraded in the presence of T4 and rT3 (186).

Nongenomic effects by TH on cell structure proteins have also been observed. Actin depolymerization blocks type II deiodinase inactivation by T4 in cAMP-stimulated glial cells, suggesting that an intact actin-cytoskeleton is required for down-regulation of deiodinase activity (185,187). Surprisingly, T4, but not T3, promotes actin polymerization in astrocytes (188) and may influence the down-regulation of type II deiodinase activity by a secondary mechanism such as targeting to lysosomes (185,187). Additionally, regulation of actin polymerization may contribute to TH effects of TH on neuronal arborization, axonal transport, and cell-cell contacts during central nervous system development. In this connection, it has been shown that T4 is required for integrin clustering and attachment to laminin by integrin in astrocytes (189).

TH may have direct effects on mitochondria and may account for some of the known T3 effects on mitochondrial activity and cellular energy state. Sterling and colleagues have suggested the site of TH action in mitochondria is the adenine nucleotide translocase of the inner mitochondrial membrane (190,191). However, this work has been difficult to confirm, as there are conflicting reports on the site of TH action in mitochondria (5,192,193). Of note, a 43 kD protein related to TRα-1 LBD has been described in mitochondria that also could bind to TREs and mitochondrial DNA sequences (194,195). Transfection of TRα-1 in CV-1 cells resulted in mitochondrial localization and stimulation of mitochondrial activity. These results raise the intriguing possibility that there may be specific mitochondrial receptors for T3 that may also serve as transcription factors in mitochondria.

TH can modulate kinase activities in the cell; thus, there can be cross-talk among plasma membrane receptors, intracellular signaling pathways, and even TRs. Lin and coworkers have observed that the antiviral effects of interferon α can be potentiated by T4 and T3 (196). These effects were rapid and did not require protein synthesis, as they were not blocked by cycloheximide treatment, and required PKC and PKA activation. The authors also recently showed that T4 can activate mitogen-activated protein kinase, phosphorylate p53, and TRβ-1 (197,198). In the latter case, it is possible that phosphorylation of TRβ-1 may help promote corepressor release from the unliganded receptor TRβ-1.

The foregoing data suggest that THs may have rapid nongenomic activities. However, the precise molecular mechanisms, including putative membrane and intracellular receptors, remain to be elucidated. Moreover, it is not known whether any of these effects may be mediated by the classical TRs since there is evidence for nuclear-cytoplasmic shuttling of TRs and other NRs (169,199,200). Recently, a novel metabolite of TH has been described, which does not bind to nuclear TRs but is an agonist for an orphan G protein–coupled receptor (201). Rodents injected with this metabolite had decreased temperature and cardiac output, suggesting this metabolite may oppose actions of TH. Discovery of natural and synthetic TH analogues that can distinguish between nongenomic and nuclear TR-mediated pathways will prove useful in determining nongenomic functions of THs.

SUMMARY

Much has been learned about the molecular mechanisms of nuclear TH action in recent years. With the availability of new techniques, such as microarray and proteomic studies, structural biology approaches, chromatin immunoprecipitation assays, in vitro transcriptional systems, and genetically altered animal models, much new information is anticipated for the future. It is hoped that such information will not only provide a better understanding of the molecular pathophysiology of diseases caused by abnormal levels of circulating TH, but could lead to the development of specific agonists, antagonists, and transcriptional modifiers that could potentially serve as valuable therapeutic agents.

REFERENCES

1. Oppenheimer JH, Schwartz HL, Mariash CN, et al. Advances in our understanding of thyroid hormone action at the cellular level. Endocr Rev 1987;8:288–308.

2. Brent GA. The molecular basis of thyroid hormone action. N Engl J Med 1994;331:847–853.

3. Yen PM. Physiological and molecular basis of thyroid hormone action. Physiol Rev 2001;81:1097–1142.

4. Magnus-Levey A. Ueber den respiratorischen gasweschsel unter dem einfluss der thyroidea sowie unter vershiedenen pathologische zustand. Ber Klin Wschr 1895;32:650.

5. Davis PJ, Davis FB. Nongenomic actions of thyroid hormone. Thyroid 1996;6:497–504.

6. Tata JR, Widnell CC. Ribonucleic acid synthesis during the early action of thyroid hormones. Biochemical Journal 1966;98: 604–629.

7. Oppenheimer JH, Koerner D, Schwartz HL, et al. Specific nuclear triiodothyronine binding sites in rat liver and kidney. J Clin Endocrinol Metab 1972;35:330–333.

8. Samuels HH, Tsai JS. Thyroid hormone action in cell culture: demonstration of nuclear receptors in intact cells and isolated nuclei. Proc Natl Acad Sci USA 1973;70:3488–3492.

9. Sap J, Munoz A, Damm K. The c-erbA protein is a high affinity receptor for thyroid hormone. Nature 1986;324:635–640.

10. Weinberger C, Thompson CC, Ong ES, et al. The c-erbA gene encodes a thyroid hormone receptor. Nature 1986;324:641–646.

11. Harvey CB, Williams GR. Mechanism of thyroid hormone action. Thyroid 2002;12:441–446.

12. Forrest, D, Vennstrom B. Functions of thyroid hormone receptors in mice. Thyroid 2000;10:41–52.

13. Flamant, F, Samarut J. Thyroid hormone receptor: lessons from knockout and knock-in mice. Trends in Endocrinology and Metabolism 2003;14:85–90.

14. Braverman LE, Ingbar SH, Sterling K. Conversion of thyroxine (T4) to triiodothyronine (T3) in athyreotic human subjects. J Clin Invest 1970;49:855–864.

15. Kohrle, J. The selenoenzyme family of deiodinase isozymes controls local thyroid hormone availability. Reviews in Endocrine and Metabolic Disorders 2000;1:49–58.

16. Larsen, PR, Berry MJ. Nutritional and hormonal regulation of thyroid hormone deiodinases. Annu Rev Nutr 1995;15:323–352.

17. Engler D, Burger AG. The deiodination of the iodothyronines and of their derivatives in man. Endocr Rev 1984;5:151–184.

18. Perlman AJ, Stanley F, Samuels HH. Thyroid hormone nuclear receptor. Evidence for multimeric organization in chromatin. J Biol Chem 1982;257:930–938.

19. Jump DB, Seelig S, Schwartz HL, et al. Association of the thyroid hormone receptor with rat liver chromatin. Biochemistry 1981;20:6781–6789.

20. MacLeod KM, Baxter JD. Chromatin receptors for thyroid hormones. Interactions of the solubilized proteins with DNA. J Biol Chem 1976;251:7380–7387.

21. McKenna NJ, Lanz RB, O'Malley BW. Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 1999;20:321–344.

22. Zhang J, Lazar MA. The mechanism of action of thyroid hormones. Annu Rev Physiol 2000;62:439–466.

23. Cheng SY. Multiple mechanisms for regulation of the transcriptional activity of tyroid hormone receptors. Reviews in Endocrine and Metabolic Disorders 2000;1/2:9–18.

24. Wagner RL, Apriletti JW, McGrath ME, et al. A structural role for hormone in the thyroid hormone receptor. Nature 1995; 378: 690–697.

25. Ribeiro RC, Feng W, Wagner RL, et al. Definition of the surface in the thyroid hormone receptor ligand binding domain for association as homodimers and heterodimers with retinoid × receptor. J Biol Chem 2001;276:14987–14995.

26. Perissi V, Staszewski LM, McInerney EM, et al. Molecular determinants of nuclear receptor-corepressor interaction. Genes Dev 1999;13:3198–3208.

27. Nagy L, Kao HY, Love JD, et al. Mechanism of corepressor binding and release from nuclear hormone receptors. Genes Dev 1999;13:3209–3216.

28. Feng W, Ribeiro RC, Wagner RL, et al. Hormone-dependent coactivator binding to a hydrophobic cleft on nuclear receptors. Science 1998;280:1747–1749.

29. Hu X, Lazar MA. The CoRNR motif controls the recruitment of corepressors by nuclear hormone receptors. Nature 1999; 402: 93–96.

30. Koenig RJ, Lazar MA, Hodin RA, et al. Inhibition of thyroid hormone action by a non-hormone binding c-erbA protein generated by alternative mRNA splicing. Nature 1989;337:659–661.

31. Lazar MA, Hodin RA, Chin WW. Human carboxyl-terminal variant of a-type c-erbA inhibits trans-activation by thyroid hormone receptors without binding thyroid hormone. Proc Natl Acad Sci USA 1989;86:7771–7774.

32. Katz D, Reginato MJ, Lazar MA. Functional regulation of thyroid hormone receptor variant TR alpha 2 by phosphorylation. Mol Cell Biol 1995;15:2341–2348.

33. Mitsuhashi TG, Tennyson GE, Nikodem VM. Alternative splicing generates messages encoding rat c-erbA proteins that do not bind thyroid hormone. Proc Natl Acad Sci USA 1988;85: 5804–5808.

34. Lazar MA, Hodin RA, Darling DS, et al. A novel member of the thyroid/steroid hormone receptor family is encoded by the opposite strand of the rat c-erbAa transcriptional unit. Mol Cell Biol 1989;9:1128–1136.

35. Miyajima N, Horiuchi R, Shibuya Y, et al. Two erbA homologs encoding proteins with different T3 binding capacities are transcribed from opposite DNA strands of the same genetic locus. Cell 1989;57:31–39.

36. Spanjaard RA, Nguyen VP, Chin WW. Rat Rev-erbA alpha, an orphan receptor related to thyroid hormone receptor, binds to specific thyroid hormone response elements. Mol Endocrinol 1994;8:286–295.

37. Harding HP, Lazar MA. The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Mol Cell Biol 1995;15:4791–4802.

38. Zamir I, Harding HP, Adkins GB, et al. A nuclear hormone receptor corepressor mediates transcriptional silencing by receptors with distinct repression domains. Mol Cell Biol 1996;16: 5458–5465.

39. Lazar MA, Hodin RA, Cardona GR, et al. Gene expression from the c-erbAa/Rev-erbAa genomic locus: potential regulation of alternative splicing by complementary transcripts from opposite DNA strands. J Biol Chem 1990;265:12859–12863.

40. Chawla A, Lazar MA. Induction of Rev-ErbA alpha, an orphan receptor encoded on the opposite strand of the alpha-thyroid hormone receptor gene, during adipocyte differentiation. J Biol Chem 1993;268:16265–16269.

41. Jeannin E, Robyr D, Desvergne B. Transcriptional regulatory patterns of the myelin basic protein and malic enzyme genes by the thyroid hormone receptors alpha1 and beta1. J Biol Chem 1998;273:24239–24248.

42. Hodin RA, Lazar MA, Wintman BI, et al. Identification of a novel thyroid hormone receptor that is pituitary-specific. Science 1989;244:76–79.

43. Lazar MA. Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 1993;14:348–399.

44. Wood WM, Dowding JM, Bright TM, et al. Thyroid hormone receptor beta2 promoter activity in pituitary cells is regulated by Pit-1. J Biol Chem 1996;271:24213–24220.

45. Hodin RA, Lazar MA, Chin WW. Differential and tissue-specific regulation of the multiple rat c-erbA mRNA species by thyroid hormone. J Clin Invest 1990;85:101–105.

46. Strait KA, Schwartz HL, Perez-Castillo A, Oppenheimer J.H. Relationship of c-erbA mRNA content to tissue triiodothyronine nuclear binding capacity and function in developing and adult rats. J Biol Chem 1990;265:10514–10521.

47. Yen PM, Sunday ME, Darling DS, et al. Isoform-specific thyroid hormone receptor antibodies detect multiple thyroid hormone receptors in rat and human pituitaries. Endocrinology 1992;130:1539–1546.

48. Bradley DJ, Towle HC, Young WS. Alpha and beta thyroid hormone receptor (TR) gene expression during auditory neurogenesis: evidence for TR isoform-specific transcriptional regulation in vivo. Proc Natl Acad Sci USA 1994;91:439–443.

49. Bradley DJ, Towle HC, Young WS. Spatial and temporal expression of a- and b-thyroid hormone receptor mRNAs, including the b2–subtype, in the developing mammalian system. J Neurosci 1992;12:2288–2302.

50. Cook CB, Kakucska I, Lechan RM, et al. Expression of thyroid hormone receptor b2 in rat hypothalamus. Endocrinology 1992;130:1077–1079.

51. Sjoberg M, Vennstrom B, Forrrest D. Thyroid hormone receptors in chick retinal development: differential expression of mRNAs for alpha and N-terminal variant beta receptors. Development 1992;114:39–47.

52. Chassande O, Fraichard A, Gauthier K, et al. Identification of transcripts initiated from an internal promoter in the c-erbA alpha locus that encode inhibitors of retinoic acid receptor-alpha and triiodothyronine receptor activities. Mol Endocrinol 1997; 11:1278–1290.

53. Williams GR. Cloning and characterization of two novel thyroid hormone receptor (beta) variants. Mol Cell Biol 2000; 20:8329–8342.

54. Jones KE, Chin WW. Differential regulation of thyroid hormone receptor messenger ribonucleic acid levels by thyrotropin-releasing hormone. Endocrinology 1991;128:1763–1768.

55. Jones KE, Yaffe BM, Chin WW. Regulation of thyroid hormone receptor b-2 mRNA levels by retinoic acid. Mol Cell Endocrinol 1993;91:113–118.

56. Davis KD, Lazar MA. Selective antagonism of thyroid hormone action by retinoic acid. J Biol Chem 1992;267:3185–3189.

57. Williams GR, Franklyn JA, Neuberger JM, et al. Thyroid hormone receptor expression in the “sick euthyroid” syndrome. Lancet 1989;2:1477–1481.

58. Darling DS, Carter RL, Yen PM, et al. Different dimerization activities of a and b thyroid hormone receptor isoforms. J Biol Chem 1993;268:10221–10227.

59. Lazar MA. Sodium butyrate selectively alters thyroid hormone receptor gene expression in GH3 cells. J Biol Chem 1990;265: 17474–17477.

60. Farsetti A, Desvergne B, Hallenbeck P, et al. Characterization of myelin basic protein thyroid hormone response element and its function in the context of native and heterologous promoter. J Biol Chem 1992;267:15784–15788.

61. Lezoualc'h F, Hassan AH, Giraud P, et al. Assignment of the beta-thyroid hormone receptor to 3,5,3′-triiodothyronine-dependent inhibition of transcription from thyrotropin-releasing hormone promoter in chick hypothalamic neurons. Mol Endocrinol 1992;6:1797–1804.

62. Hollenberg AN, Monden T, Wondisford FE. Ligand-independent and -dependent functions of thyroid hormone receptor isoforms depend upon on their distinct amino terminal. J Biol Chem 1995;270:14272–14280.

63. Abel ED, Kaulbach HC, Campos-Barros A, et al. Novel insight from transgenic mice into thyroid hormone resistance and the regulation of thyrotropin. J Clin Invest 1999;103: 271–279.

64. Yen PM, Feng X, Flamant F, et al. Effects of ligand and thyroid hormone receptor isoforms on hepatic gene expression profiles of thyroid hormone receptor knockout mice. EMBO Rep 2003; 4:581–587.

65. Ball SG, Ikeda M, Chin WW. Deletion of the thyroid hormone beta1 receptor increases basal and triiodothyronine-induced growth hormone messenger ribonucleic acid in GH3 cells. Endocrinology 1997;138:3125–3132.

66. Chiellini G, Apriletti JW, al Yoshihara H, et al. A high-affinity subtype-selective agonist ligand for the thyroid hormone receptor. Chem Biol 1998;5:299–306.

67. Yen PM. Molecular basis of resistance to thyroid hormone. Trends in Endocrinology Metabolism 2003;14:327–333.

68. Baxter JD, Goede P, Apriletti JW, et al. Structure-based design and synthesis of a thyroid hormone receptor (TR) antagonist. Endocrinology 2002;143:517–524.

69. Dillmann WH. Cellular action of thyroid hormone on the heart. Thyroid 2002;12:447–452.

70. Williams GR, Brent GA. Thyroid hormone response elements. In: Weintraub B, ed. Molecular endocrinology: basic concepts and clinical correlations. New York: Raven Press, 1995:217–239.

71. Glass CK. Differential recognition of target genes by nuclear receptor monomers, dimers and heterodimers. Endocr Rev 1994;15:391–407.

72. Yen PM, Brubaker JH, Apriletti JW, et al. Roles of T3 and DNA-binding on thyroid hormone receptor complex formation. Endocrinology 1994;134:1075–1081.

73. Umesono K, Murakami K, Thompson CC, et al. Direct repeats as selective response elements for the thyroid hormone, retinoic acid, vitamin D3 receptors. Cell 1991;65:1255–1266.

74. Naar AM, Boutin JM, Lipkin SM, et al. The orientation and spacing of core DNA-binding motifs dictate selective transcriptional responses to three nuclear receptors. Cell 1991;65:1255–1266.

75. Kurokawa R, Soderstrom M, Horlein A, et al. Polarity-specific activities of retinoic acid receptors determined by a co-repressor. Nature 1995;377:451–454.

76. Perlmann T, Rangarajan PN, Umesono K, et al. Determinants for selective RAR and TR recognition of direct repeat HREs. Genes Dev 1993;7:1411–1422.

77. Yen PM, Ikeda M, Wilcox EC, et al. Half-site arrangement of hybrid glucocorticoid and thyroid hormone response elements specifies thyroid hormone receptor complex binding to DNA and transcriptional activity. J Biol Chem 1994;269:12704–12709.

78. Rastinejad F, Perlmann T, Evans RM, et al. Structural determinants of nuclear receptor assembly on DNA direct repeats. Nature 1995;375:203–211.

79. Nagaya T, Jameson JL. Distinct dimerization domains provide antagonist pathways for thyroid hormone receptor action. J Biol Chem 1993;268:24278–24282.

80. Au-Fliegner M, Helmer E, Casanova J, et al. The conserved ninth C-terminal heptad in thyroid hormone and retinoic acid receptors mediates diverse responses by affecting heterodimer but not homodimer formation. Mol Cell Biol 1993;13:5725–5737.

81. Collingwood TN, Butler A, Tone Y, et al. Thyroid hormone-mediated enhancement of heterodimer formation between thyroid hormone receptor beta and retinoid × receptor. J Biol Chem 1997;272:13060–13065.

82. Levin AA, Sturzenbecker LJ, Kaxmer S, et al. 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXRa. Nature 1992;355:359–361.

83. Heyman RA, Mangelsdorf DJK, Dyk JA, et al. 9-cis retinoic acid is a high affinity ligand for the retinoid × receptor. Cell 1992;68:397–440.

84. Rosen ED, O'Donnell AL, Koenig RJ. Ligand-dependent synergy of thyroid hormone and retinoid × receptors. J Biol Chem 1992;267:22010–22013.

85. Feng X, Jiang Y, Meltzer P, et al. Thyroid hormone regulation of hepatic genes in vivo detected by complementary DNA microarray. Mol Endocrinol 2000;14:947–955.

86. Flores-Morales A, Gullberg H, Fernandez L, et al. Patterns of liver gene expression governed by TRbeta. Mol Endocrinol 2002;16:1257–1268.

87. Krane IM, Spindel ER., Chin WW. Thyroid hormone decreases the stability and the poly(A) tract length of rat thyrotropin beta-subunit messenger RNA.Mol Endocrinol 1991; 5:469–475.

88. Leedman PJ, Stein AR, Chin WW. Regulated specific protein binding to a conserved region of the 3′-untranslated region of thyrotropin beta-subunit mRNA. Mol Endocrinol 1995;9:375–387.

89. Brent GA, Dunn MK, Harney JW, et al. Thyroid hormone aporeceptor represses T3-inducible promoters and blocks activity of the retinoic acid receptor. New Biologist 1989;1:329–336.

90. Horlein AJ, Naar AM, Heinzel T, et al. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear co-repressor. Nature 1995;377:397–404.

91. Chen JD, Evans RM. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 1995;377:454–457.

92. Seol W, Choi HS, Moore DD. Isolation of proteins that interact specifically with the retinoid × receptor: two novel orphan receptors. Mol Endocrinol 1995;9:72–85.

93. Hu I, Lazar MA. Transcriptional repression by nuclear hormone receptors. Trends in Endocrinology Metabolism 2000;11:6–10.

94. Zhang J, Hu X, Lazar MA. A novel role for helix 12 of retinoid × receptor in regulating repression. Mol Cell Biol 1999;19: 6448–6457.

95. Wong J, Shi YB, Wolffe AP. A role for nucleosome asembly in both silencing and actiation of the xenopus TR beta A gene by the thyroid hormone receptor. Genes Dev 1996;9:2696–1711.

96. Nan X, Ng HH, Johnson CA, et al. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 1998;393:386–389.

97. Baniahmad A, Ha I, Reinberg D, et al. Interaction of human thyroid hormone receptor b with transcription factor TFIIB may mediate target gene derepression and activation by thyroid hormone. Proc Natl Acad Sci USA 1993;90:8832–8836.

98. Hadzic E, Desai-Yajnik V, Helmer E, et al. A 10 amino acid sequence in the N-terminal A/B domain of thyroid hormone receptor alpha is essential for transcriptional activation and interaction with the general transcription factor TFIIB. Mol Cell Biol 1995;15:4507–4517.

99. Onate SA, Tsai SY, Tsai MJ, et al. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 1995;270:1354–1357.

100. McInerney EM, Rose DW, Flynn SE, et al. Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev 1998;12:3357–3368.

101. Heery DM, Kalkhoven E, Hoare S, et al. A signature motif in transcriptional co-activators mediates binding to nuclear receptors. Nature 1997;387:733–736.

102. Torchia J, Glass C, Rosenfeld MG. Co-activators and co-repressors in the integration of transcriptional responses. Curr Opin Cell Biol 1998;10:373–383.

103. Nakajima T, Uchida C, Anderson SF, et al. RNA helicase A mediates association of CBP with RNA polymerase II. Cell 1997;90:1107–1112.

104. Ito M, Roeder RG. The TRAP/SMCC/Mediator complex and thyroid hormone receptor function. Trends in Endocrinology Metabolism 2001;12:127–134.

105. Rachez C, Freedman LP. Mediator complexes and transcription. Curr Opin Cell Biol 2001;13:274–280.

106. Ko L, Cardona GR, Chin WW. Thyroid hormone receptor-binding protein, an LXXLL motif-containing protein, functions as a general coactivator. Proc Natl Acad Sci USA 2000;97: 6212–6217.

107. Ko L, Chin WW. Nuclear receptor coactivator thyroid hormone receptor-binding protein (TRBP) interacts with and stimulates its associated DNA-dependent protein kinase. J Biol Chem 2003;278:11471–11479.

108. Sharma D, Fondell JD. Ordered recruitment of histone acetyltransferases and the TRAP/mediator complex to thyroid hormone-responsive promoters in vivo. Proc Natl Acad Sci USA 2002;99:7934–7939.

109. Shang Y, Hu X, DiRenzo J, et al. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 2000; 103:843–852.

110. Reid G, Hubner MR, Metivier R, et al. Cyclic, proteasome-mediated turnover of unliganded and liganded ERalpha on responsive promoters is an integral feature of estrogen signaling. Mol Cell 2003;11:695–707.

111. Li X, Wong J, Tsai SY, et al. Progesterone and glucocorticoid receptors recruit distinct coactivator complexes and promote distinct patterns of local chromatin modification. Mol Cell Biol 2003;23:3763–3773.

112. Chen H, Lin RJ, Schiltz RL, et al. Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 1997;90:569–580.

113. DiRenzo J, Shang Y, Phelan M, et al. BRG-1 is recruited to estrogen-responsive promoters and cooperates with factors involved in histone acetylation. Mol Cell Biol 2000;20:7541–7549.

114. Bodenner DL, Mroczynski MA, Weintraub BD, et al. A detailed functional and structural analysis of a major thyroid hormone inhibitory element in the human thyrotropin beta-subunit gene. J Biol Chem 1991;266:21666–21673.

115. Chatterjee VK, Lee JK, Rentoumis A, et al. Negative regulation of the thyroid-stimulating hormone alpha gene by thyroid hormone: receptor interaction adjacent to the TATA box. Proc Natl Acad Sci USA 1989;86:9114–9118.

116. Hollenberg AN, Monden T, Flynn TR, et al. The human thyrotropin-releasing hormone gene is regulated by thyroid hormone through two distinct classes of negative thyroid hormone response elements. Mol Endocrinol 1995;9:540–550.

117. Madison LD, Ahlquist JA, Rogers SD, et al. Negative regulation of the glycoprotein hormone a subunit gene promoter by thyroid hormone: mutagenesis of a proximal receptor binding site preserves transcriptional repression. Mol Cell Endocrinol 1993;94:129–136.

118. Zhang XK, Wills KN, Husmann M, et al. Novel pathway for thyroid hormone receptor action through interaction with Jun and Fos oncogene activities. Mol Cell Biol 1991;11:6016–6025.

119. Pernasetti, F, Caccavelli L, Van de Weerdt C, et al. Thyroid hormone inhibits the human prolactin gene promoter by interfering with activating protein-1 and estrogen stimulations. Mol Endocrinol 1997;11:986–996.

120. Tansey WP, Catanzaro DF. Sp1 and thyroid hormone receptor differentially activate expression of human growth hormone and chorionic somatomammotropin genes. J Biol Chem 1991; 266:9805–9813.

121. Schaufele F, West BL, Reudelhuber TL. Overlapping Pit-1 and Sp1 binding sites are both essential to full rat growth hormone gene promoter activity despite mutually exclusive Pit-1 and Sp1 binding. J Biol Chem 1990;265:17189–17196.

122. Barrera-Hernandez G, Zhan Q, Wong R, et al. Thyroid hormone receptor is a negative regulator in p53–mediated signaling pathways. DNA Cell Biol 1998;17:743–750.

123. Qi JS, Yuan Y, Desai-Yajnik V, et al. Regulation of the mdm2 oncogene by thyroid hormone receptor. Mol Cell Biol 1999; 19:864–872.

124. Lutz M, Burke LJ, LeFevre P, et al. Thyroid hormone-regulated enhancer blocking: cooperation of CTCF and thyroid hormone receptor. EMBO J 2003;22:1579–1587.

125. Tagami T, Madison LD, Nagaya T, et al. Nuclear receptor corepressors activate rather than suppress basal transcription of genes that are negatively regulated by thyroid hormone. Mol Cell Biol 1997;17:2642–2648.

126. Sasaki S, Lesoon-Wood LA, Dey A, et al. Ligand-induced recruitment of a histone deacetylase in the negative-feedback regulation of the thyrotropin beta gene. EMBO J 1999;18:5389–5398.

127. Abel ED, Boers ME, Pazos-Moura C, et al. Divergent roles for thyroid hormone receptor beta isoforms in the endocrine axis and auditory system. J Clin Invest 1999;104:291–300.

128. Langlois M.F, Zanger K, Monden T, et al. A unique role of the beta-2 thyroid hormone receptor isoform in negative regulation by thyroid hormone: mapping of a novel amino-terminal domain important for ligand-independent activation. J Biol Chem 1997;272:24927–24933.

129. Refetoff S, Weiss RA, Usala SJ. The syndromes of resistance to thyroid hormone. Endocr Rev 1993;14:348–399.

130. Beck-Peccoz P, Chatterjee VK. The variable clinical phenotype in thyroid hormone resistance syndrome. Thyroid 1994;4:225–232.

131. Yen PM, Sugawara A, Refetoff S, et al. New insights on the mechanism(s) of the dominant negative effect of mutant thyroid hormone receptor in generalized resistance to thyroid hormone. J Clin Invest 1992;90:1825–1831.

132. Collingwood TN, Rajanayagam O, Adams M, et al. A natural transactivation mutation in the thyroid hormone b receptor: impaired interaction with putative transcriptional mediators. Proc Natl Acad Sci USA 1997;94:248–253.

133. Liu Y, Takeshita A, Misiti S, et al. Lack of coactivator interaction can be a mechanism for dominant negative activity by mutant thyroid hormone receptors. Endocrinology 1998;139: 4197–4204.

134. Tagami T, Gu WX, Peairs PT, et al. A novel natural mutation in the thyroid hormone receptor defines a dual functional domain that exchanges nuclear receptor corepressors and coactivators. Mol Endocrinol 1998;12:1888–1902.

135. Yoh SM, Chatterjee VK, Privalsky ML. Thyroid hormone resistance manifests as an aberrant interaction between mutant T3 receptors and transcriptional corepressors. Mol Endocrinol 1997;11:470–480.

136. Tagami T, Jameson JL. Nuclear corepressors enhance the dominant negative activity of mutant receptors that cause resistance to thyroid hormone. Endocrinology 1998;139:640–650.

137. Safer JD, Cohen RN, Hollenberg AN, et al. Defective release of corepressor by hinge mutants of the thyroid hormone receptor found in patients with resistance to thyroid hormone. J Biol Chem 1998;273:30175–30182.

138. Pohlenz J, Weiss RE, Macchia PE, et al. Five new families with resistance to thyroid hormone not caused by mutations in the thyroid hormone receptor beta gene. J Clin Endocrinol Metab 1999;84:3919–3928.

139. Weiss RE, Xu J, Ning G, et al. Mice deficient in the steroid receptor co-activator 1 (SRC-1) are resistant to thyroid hormone. EMBO J 1999;18:1900–1904.

140. Lin K-H, Zhu X-G, Shieh H-Y, et al. Identification of naturally occurring dominant negative mutants of thyroid hormone a1 and b1 receptors in a human hepatocellular carcinoma cell lines. Endocrinology 1996;137:4073–4081.

141. Yen P, Cheng S. Somatic thyroid hormone receptor mutations in man. J Endocrinol Invest 2003;26:780–787.

142. Ando S, Sarlis NJ, Krishnan J, et al. Aberrant alternative splicing of thyroid hormone receptor in a TSH-secreting pituitary tumor is a mechanism for hormone resistance. Mol Endocrinol 2001;15:1529–1538.

143. Ando S, Sarlis NJ, Oldfield EH, et al. Somatic mutation of TRbeta can cause a defect in negative regulation of TSH in a TSH-secreting pituitary tumor. J Clin Endocrinol Metab 2001;86: 5572–5576.

144. Kaneshige M, Kaneshige K, Zhu X, et al. Mice with a targeted mutation in the thyroid hormone beta receptor gene exhibit impaired growth and resistance to thyroid hormone. Proc Natl Acad Sci USA 2000;97:13209–13214.

145. Hashimoto K, Curty FH, Borges PP, et al. An unliganded thyroid hormone receptor causes severe neurological dysfunction. Proc Natl Acad Sci USA 2001;98:3998–4003.

146. Kaneshige M, Suzuki H, Kaneshige K, et al. A targeted dominant negative mutation of the thyroid hormone alpha 1 receptor causes increased mortality, infertility, dwarfism in mice. Proc Natl Acad Sci USA 2001;98:15095–15100.

147. Tinnikov A, Nordstrom K, Thoren P, et al. Retardation of post-natal development caused by a negatively acting thyroid hormone receptor alpha1. EMBO J 2002;21:5079–5087.

148. Barlow C, Meister B, Lardelli M, et al. Thyroid abnormalities and hepatocellular carcinoma in mice transgenic for v-erbA. EMBO J 1994;13:4241–4250.

149. Wong R, Vasilyev VV, Ting YT, et al. Transgenic mice bearing a human mutant thyroid hormone beta 1 receptor manifest thyroid function anomalies, weight reduction, hyperactivity. Mol Med 1997;3:303–314.

150. Fraichard A, Chassande O, Plateroti M, et al. The T3R alpha gene encoding a thyroid hormone receptor is essential for post-natal development and thyroid hormone production. EMBO J 1997;16:4412–4420.

151. Wikstrom L, Johansson C, Salto C, et al. Abnormal heart rate and body temperature in mice lacking thyroid hormone receptor alpha 1. Embo J 1998;17:455–461.

152. Macchia PE, Takeuchi Y, Kawai T, et al. Increased sensitivity to thyroid hormone in mice with complete deficiency of thyroid hormone receptor alpha. Proc Natl Acad Sci USA 2001;98: 349–354.

153. Forrest D, Hanebuth E, Smeyne RJ, et al. Recessive resistance to thyroid hormone in mice lacking thyroid hormone receptor beta: evidence for tissue-specific modulation of receptor function. EMBO J 1996;15:3006–3015.

154. Forrest D, Erway LC, Ng L, et al. Thyroid hormone receptor beta is essential for development of auditory function. Nat Genet 1996;13:354–357.

155. Refetoff S, DeWind LT, DeGroot LJ. Familial syndrome combining deaf-mutism, stippled epiphyses, goiter and abnormally high PBI: possible target organ refractoriness to thyroid hormone. J Clin Endocrinol Metab 1967;27:279–294.

156. Weiss RE, Forrest D, Pohlenz J, et al. Thyrotropin regulation by thyroid hormone in thyroid hormone receptor beta-deficient mice. Endocrinology 1997;138:3624–3629.

157. Ng L, Rusch A, Amma LL, et al. Suppression of the deafness and thyroid dysfunction in Thrb-null mice by an independent mutation in the Thra thyroid hormone receptor alpha gene. Hum Mol Genet 2001;10:2701–2708.

158. Gothe S, Wang Z, Ng L, et al. Mice devoid of all known thyroid hormone receptors are viable but exhibit disorders of the pituitary-thyroid axis, growth, bone maturation. Genes Dev 1999;13:1329–1341.

159. Gauthier K, Chassande O, Plateroti M, et al. Different functions for the thyroid hormone receptors TRalpha and TRbeta in the control of thyroid hormone production and post-natal development. EMBO J 1999;18:623–631.

160. Suzuki H, Willingham MC, Cheng SY. Mice with a mutation in the thyroid hormone receptor beta gene spontaneously develop thyroid carcinoma: a mouse model of thyroid carcinogenesis. Thyroid 2002;12:963–969.

161. Liu YY, Schultz JJ, Brent GA. A thyroid hormone receptor alpha gene mutation (P398H) is associated with visceral adiposity and impaired catecholamine-stimulated lipolysis in mice. J Biol Chem 2003;278:38913–38920.

162. Shibusawa N, Hashimoto K, Nikrodhanond AA, et al. Thyroid hormone action in the absence of thyroid hormone receptor DNA-binding in vivo. J Clin Invest 2003;112:588–597.

163. Saatcioglu F, Deng T, Karin M. A novel cis element mediating ligand-independent activation by c-erbA: implications for hormonal regulation. Cell 1993;75:1095–1105.

164. Lakshmanan M, Goncalves E, Lessly G et al. The transport of thyroxine into mouse neuroblastoma cells, NB41A3: the effect of L-system amino acids. Endocrinology 1990;126:3245–3250.

165. Osty J, Valensi P, Samson M, et al. Transport of thyroid hormones by human erythrocytes: kinetic characterization in adults and newborns. J Clin Endocrinol Metab 1990;71:1589–1595.

166. Samson M, Osty J, Blondeau JP. Identification by photoaffinity labeling of a membrane thyroid hormone-binding protein associated with the triiodothyronine transport system in rat erythrocytes. Endocrinology 1993;132:2470–2476.

167. Mooradian AD, Schwartz HL, Mariash CN, et al. Transcellular and transnuclear transport of 3,5,3′-triiodothyronine in isolated hepatocytes. Endocrinology 1985;117:2449–2456.

168. Ribeiro RCJ, Cavalieri RR, Lomri N, et al. Thyroid hormone export regulates cellular hormone content and response. J Biol Chem 1996;271:17147–17151.

169. Baumann CT, Maruvada P, Hager GL, et al. Nuclear cytoplasmic shuttling by thyroid hormone receptors. multiple protein interactions are required for nuclear retention. J Biol Chem 2001;276:11237–11245.

170. Abe T, Kakyo M, Tokui T, et al. Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem 1999;274:17159–17163.

171. Friesema EC, Docter R, Moerings EP, et al. Identification of thyroid hormone transporters. Biochem Biophys Res Commun 1999;254:497–501.

172. Friesema EC, Ganguly S, Abdalla A, et al. Identification of monocarboxylate transporter 8 as a specific thyroid hormone transporter. J Biol Chem 2003;278:40128–40135.

173. Ritchie JW, Shi YB, Hayashi Y, et al. A role for thyroid hormone transporters in transcriptional regulation by thyroid hormone receptors. Mol Endocrinol 2003;17:653–661.

174. Pizzagalli F, Hagenbuch B, Stieger B, et al. Identification of a novel human organic anion transporting polypeptide as a high affinity thyroxine transporter. Mol Endocrinol 2002;16:2283–2296.

175. Friesema E, Gruters A, Halestrap A, et al. Mutations in a thyroid hormone transporter in young boys with sever psychomotor retardation and high serum T3 levels: a novel mechanism of thyroid hormone resistance. In: 6th International Workshop on Resistance to Thyroid Hormone; 13–15 September 2003; Miami, FL. Abstract 2.

176. Dumitrescu AM, Liao XH, Best TB, et al. A novel syndrome combining thyroid and neurological abnormalities is associated with mutations in a monocarboxylate transporter gene. Am J Hum Genet 2004;74:168–175.

177. Segal J, Ingbar SH. 3,5,3′-triiodothyronine increases 3′,5′-monophosphate concentration and sugar uptake in rat thymocytes by stimulating adenylate cyclase activity: studies with the adenylate cyclase inhibitor MDL 12330A. Endocrinology 1989; 124:2166–2171.

178. Segal J, Ingbar SH. Studies on the mechanism by which 3,5,3′triiodothyronine stimulates 2–deoxyglucose uptake in rat thymocytes in vitro. Role of calcium and adenosine 3′,5′-monophosphate. J Clin Invest 1981;68:103–110.

179. Davis PJ, Blas SD. In vitro stimulation of human red blood cell Ca2+-ATPase by thyroid hormone. Biochem Biophys Res Commun. 1981;99:1073–1080.

180. Davis FB, Davis PJ, Blas SD. Role of calmodulin in thyroid hormone stimulation of in vitro human erythrocyte Ca2+-ATPase activity. J Clin Invest 1983;71:579–586.

181. Segal J, Gordon A. The effects of actinomycin D, puromycin, cycloheximide, hydroxyurea on 3′5′3–triiodo-L-thyronine stimulated 2–deoxy-D-glucose uptake in chick embryo heart cells in vitro. Endocrinology 1977;101:150–156.

182. Cheng SY, Gong QH, Parkison C, et al. The nucleotide sequence of a human cellular thyroid hormone binding protein present in endoplasmic reticulum. J Biol Chem 1987;262: 11221–11227.

183. Kato H, Fukuda T, Parkison C, et al. Cytoplasmic thyroid hormone-binding protein is a monomer of pyruvate kinase. Proc Natl Acad Sci U S A 1990;86:7681–7685.

184. Ashizawa K, McPhie P, Lin KH, et al. An in vitro novel mechanism of regulating the activity of pyruvate kinase M2 by thyroid hormone and fructose 1,6 bisphosphate. Biochemistry 1991;30:7105–7111.

185. Farwell AP, Safran M, Dubord S, et al. Degradation and recycling of the substrate-binding subunit of type II iodothyronine 5′deiodonase in astrocytes. J Biol Chem 1996;271:16369–16374.

186. Steinsapir J, Bianco AC, Buettner C, et al. Substrate-induced down-regulation of human type 2 deiodinase (hD2) is mediated through proteasomal degradation and requires interaction with the enzyme's active center. Endocrinology 2000;141:1127–1135.

187. Farwell AP, DiBenedetto DJ., Leonard JL. Thyroxine targets different pathways of internalization of type II iodothyronine 5′-deiodinase in astrocytes. J Biol Chem 1993;268:5055.

188. Siegrist-Kaiser CA, Juge-Aubry C, Tranter MP, et al. Thyroxine-dependent modulation of actin polymerization in cultured astrocytes: a novel extranuclear action of thyroid hormone. J Biol Chem 1990;265:5296–5302.

189. Farwell AP, Tranter MP, Leonard JL. Thyroxine-dependent regulation of integrin-laminin interactions in astrocytes. Endocrinology 1995;136:3909–3915.

190. Sterling K, Brenner MA. Thyroid hormone action: effect of triiodothyronine on mitochondrial adenine nucleotide translocase in vivo and in vitro. Metabolism 1995;44:193–199.

191. Romani A, Marfella C, Lakshmanan M. Mobilization of Mg2+ from rat heart and liver mitochondria following the interaction of thyroid hormone with adenine nucleotide translocase. Thyroid 1996;6:513–519.

192. Lanni A, Moreno M, Lombardi A, et al. Rapid stimulation in vitro of rat liver cytochrome oxidase activity by 3,5-diiodo-L-thyronine and by 3,3′-diiodo-L-thyronine. Mol Cell Endocrinol 1994;99:89–94.

193. Hafner RP, Brown GC, Brand MD. Thyroid hormone control of state-3 respiration in isolated rat liver mitochondria. Biochemical J 1990;265:731–734.

194. Wrutniak C, Cassar-Malek I, Marchal S, et al. A 43 kD protein related to c-erb A alpha 1 is located in the mitochondrial matrix of rat liver. J Biol Chem 1995;270:16347–16354.

195. Casas F, Rochard P, Rodier A, et al. A variant form of the nuclear triiodothyronine receptor c-erbA alpha1 plays a direct role in regulation of mitochondrial RNA synthesis. Mol Cell Biol 1999;19:7913–7924.

196. Lin H-Y, Thacore HR, Davis PJ, et al. Thyroid hormone potentiates the antiviral action of interferon-gamma in culutured human cells. J Clinl Endocrinol Metab 1994;79:62–65.

197. Shih A, Lin HY, Davis FB, et al. Thyroid hormone promotes serine phosphorylation of p53 by mitogen-activated protein kinase. Biochemistry 2001;40:2870–2878.

198. Davis PJ, Shih A, Lin HY, et al. Thyroxine promotes association of mitogen-activated protein kinase and nuclear thyroid hormone receptor (TR) and causes serine phosphorylation of TR. J Biol Chem 2000;275:38032–38039.

199. Bunn CF, Neidig JA, Freidinger KE, et al. Nucleocytoplasmic shuttling of the thyroid hormone receptor alpha. Mol Endocrinol 2001;15:512–533.

200. Maruvada P, Baumann CT, Hager GL, et al. Dynamic shuttling and intranuclear mobility of nuclear hormone receptors. J Biol Chem 2003;278:12425–12432.

201. Scanlan T. TR agonists and antagonists. In: 6th International Workshop on Resistance to Thyroid Hormone; 2003; Miami, Fl. 4.


Previous
Page
Next
Page

Contents


If you find an error or have any questions, please email us at admin@doctorlib.org. Thank you!